ID: 986187115

View in Genome Browser
Species Human (GRCh38)
Location 5:5454410-5454432
Sequence TTGTGCACAATGGTTGAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986187112_986187115 30 Left 986187112 5:5454357-5454379 CCTTCAATTTTTAGCTTAAGTAT 0: 1
1: 0
2: 2
3: 53
4: 447
Right 986187115 5:5454410-5454432 TTGTGCACAATGGTTGAGTTTGG 0: 1
1: 1
2: 0
3: 10
4: 105
986187113_986187115 1 Left 986187113 5:5454386-5454408 CCTTTTTATCAGTAACTGACTGT 0: 1
1: 1
2: 1
3: 30
4: 229
Right 986187115 5:5454410-5454432 TTGTGCACAATGGTTGAGTTTGG 0: 1
1: 1
2: 0
3: 10
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986187115 Original CRISPR TTGTGCACAATGGTTGAGTT TGG Intronic
905196162 1:36279080-36279102 ATGTGCAGAATTGTTAAGTTTGG + Intronic
908063508 1:60377054-60377076 TAGTGCAAAATGGTTGAGTATGG - Intergenic
908065376 1:60397862-60397884 TTGGGCACAGTGGTTGAGGTGGG - Intergenic
909406283 1:75293296-75293318 TTGTGCTCTAGGGTTGAGTCAGG + Intronic
910534947 1:88287038-88287060 GTGTGCACAATGGTTTAGACAGG + Intergenic
910742995 1:90541953-90541975 TTGTACAGAATGGGTGAGTTTGG - Intergenic
1068111169 10:52682342-52682364 TTGACCACAGTGATTGAGTTGGG - Intergenic
1068415298 10:56712478-56712500 TTGTGGACAATTCTTTAGTTAGG - Intergenic
1068812168 10:61268454-61268476 TTGTGCTCTTTGCTTGAGTTGGG + Intergenic
1069335916 10:67350082-67350104 TTGTGCAAAATGTTTTATTTAGG + Intronic
1069680612 10:70282815-70282837 TTGTCCACAATGGCTGAGAGAGG + Intronic
1075297449 10:121290828-121290850 TTGTTCACAATGGTTATCTTGGG - Intergenic
1077306764 11:1872058-1872080 TGGTGCACGCTGGTAGAGTTGGG + Intronic
1077306887 11:1872527-1872549 TGGTGCACGCTGGTAGAGTTGGG + Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1078286556 11:9961331-9961353 TTGTGCAAAATGTTTGAGAAAGG + Intronic
1079508259 11:21179760-21179782 TTTTGCACATAGTTTGAGTTAGG + Intronic
1080487444 11:32725186-32725208 TTTTGGACAATGGTTGACTGCGG - Intronic
1081199833 11:40202519-40202541 TTGTGTAAAATGAATGAGTTGGG + Intronic
1082887688 11:58104887-58104909 TTGTTCACAATGCTTGACTCAGG - Intronic
1085433004 11:76472585-76472607 TTGGGCACGAAGGTTGAGCTTGG - Exonic
1087262267 11:96024225-96024247 TTTTGCAAAATGCCTGAGTTTGG + Intronic
1089269263 11:117290347-117290369 TTTTGCACAACTGTTGACTTGGG + Intronic
1092657648 12:10703989-10704011 GTGTGCACAATGGTAGAATGAGG - Intronic
1097836574 12:64279213-64279235 TTTTACAAAATGGTGGAGTTGGG - Intronic
1098095552 12:66951610-66951632 CTGTGGACAATGGTTAAGTGAGG + Intergenic
1099980390 12:89594335-89594357 TTGTGCACAATACTTTAGGTAGG + Intronic
1101084836 12:101225505-101225527 TGGTGCACAGTGGTTGTCTTGGG + Intergenic
1112517667 13:100069096-100069118 TTCTGAACAATGGGTGAGATGGG + Intergenic
1122335343 14:100972939-100972961 TGGTGCATAATGGTTTATTTTGG + Intergenic
1125334938 15:38617734-38617756 TTTTGCACAATGGGTCAGTTGGG - Intergenic
1126036014 15:44546770-44546792 TTTAGCTCAATGATTGAGTTAGG + Intronic
1127536375 15:59893609-59893631 TTCTGCACAGTGGTTCACTTAGG - Intergenic
1129429359 15:75487615-75487637 TGGAGTACAGTGGTTGAGTTGGG - Intronic
1132121509 15:99179925-99179947 TTGTGAACAATGGTTGAGTTTGG - Intronic
1134199892 16:12189288-12189310 TCTTGCAAAATGGTTGAGTCCGG + Intronic
1135731595 16:24899359-24899381 TTGAGCTCAGTGGTTGGGTTGGG + Intronic
1143255252 17:5552954-5552976 TTGTGCACCATGTTGGATTTGGG - Intronic
1148109243 17:45135575-45135597 CTGTGCTGAATGGTTGAGGTAGG + Exonic
1154956185 18:21257843-21257865 ATGTGCACAATGTGTGAGGTGGG - Intronic
1156986472 18:43356295-43356317 TTGAGCAGAATGTATGAGTTTGG - Intergenic
1158850710 18:61493487-61493509 TTGTGCACGAGGGCTGAGTGAGG - Intronic
1159423524 18:68253819-68253841 TCTTCCACAATGGTTGAATTAGG - Intergenic
1164509337 19:28884841-28884863 CTTTCCACAATGGCTGAGTTAGG + Intergenic
1164576540 19:29408540-29408562 TTCTGCATAATGGTTTTGTTTGG + Intergenic
1164792231 19:30997046-30997068 CTGTGCACAGTGCTTGAGCTTGG - Intergenic
1168697511 19:58412653-58412675 TTGGCCTCAATGGATGAGTTGGG + Intronic
925138380 2:1534855-1534877 TTGTGCACAGTGGTGGGATTTGG - Intronic
925402247 2:3583521-3583543 GAGTGCACAATGGAAGAGTTTGG + Intergenic
925442737 2:3902421-3902443 CTGTGCACAATGCTTCAGTGTGG + Intergenic
930521962 2:52478854-52478876 TTGAGCAGATTGGTAGAGTTGGG + Intergenic
931216155 2:60246930-60246952 TGGCGAACAATGGTTCAGTTAGG + Intergenic
931903232 2:66814632-66814654 TTGAGTAAAATGCTTGAGTTGGG + Intergenic
932894070 2:75621906-75621928 TTGTCCAGAATGGATGAGTTTGG - Intergenic
936858167 2:116984906-116984928 TCTTCCACAATGGTTGAGCTAGG - Intergenic
938986866 2:136585057-136585079 TGAAACACAATGGTTGAGTTGGG - Intergenic
944103312 2:196052898-196052920 TGGTGAACCATTGTTGAGTTAGG - Intronic
945898186 2:215508352-215508374 TTTTGCATAGTGGTTGATTTTGG + Intergenic
946434225 2:219641359-219641381 TTGTACACCATGTTTGAGTATGG - Intronic
1175821249 20:61910116-61910138 TTGTGAACACTCGTTGAGCTGGG + Intronic
1175821260 20:61910242-61910264 TTGTGAACACTCGTTGAGCTGGG + Intronic
1179381327 21:40902044-40902066 TTTTGCACAATGTGTGAGTTAGG - Intergenic
1179827452 21:43974473-43974495 GTGTGCAAAATGGGTGGGTTTGG + Intronic
949841748 3:8327496-8327518 TTGTGCAAAATGGTAAAGCTAGG + Intergenic
951494517 3:23311451-23311473 TCTTCCACAATGGTTGAATTAGG + Intronic
951622742 3:24624208-24624230 TTGTGCACAGGGGGTGAATTTGG - Intergenic
952853096 3:37744959-37744981 TTGTGTCCTATGGGTGAGTTGGG - Intronic
962169554 3:133086796-133086818 TTGTCCACTATGGTGTAGTTTGG + Intronic
965443740 3:168748802-168748824 TTGTGCACAATGCTGGAAATGGG + Intergenic
966649815 3:182287417-182287439 TTTTGGACAATGGTTGTATTAGG - Intergenic
966988012 3:185199922-185199944 TTGTGCACAACGGTAGACGTGGG + Intronic
967276420 3:187779728-187779750 TTGTCCTCCATGGATGAGTTGGG + Intergenic
967844560 3:194033473-194033495 TTGTGTACAACGGTTTACTTTGG - Intergenic
970162381 4:13201983-13202005 TTCTGCACAATGTCTGACTTGGG + Intergenic
972383141 4:38537640-38537662 TTTTGCATAATGTTTGATTTGGG + Intergenic
975991563 4:80264375-80264397 TTGTGGACAGTGATTGAATTTGG - Intergenic
982930047 4:161393320-161393342 TTGTGCATAATTATTGAATTTGG - Intronic
986187115 5:5454410-5454432 TTGTGCACAATGGTTGAGTTTGG + Intronic
987595265 5:19989136-19989158 ATGTGCTCAATGGGTGAGTGTGG - Intronic
990284625 5:54288589-54288611 TTGCTCATAATGATTGAGTTTGG - Intronic
990664521 5:58056526-58056548 TTGATGACAATGGTTGAGTATGG - Intergenic
991560161 5:67942554-67942576 TTGTGCCCAATGGATGAGTCAGG + Intergenic
994361387 5:98852335-98852357 TAGTGTAAAAGGGTTGAGTTTGG + Intergenic
997841776 5:137247493-137247515 TTCTGCACTATGGTTGATTATGG - Intronic
997886367 5:137633899-137633921 TATTGCATAATGGTCGAGTTTGG - Intronic
1000442606 5:161281401-161281423 TTGTGCATAATGATGTAGTTTGG - Intergenic
1001071763 5:168591651-168591673 TTGTGAACCATGTTAGAGTTTGG + Intergenic
1008913218 6:56758905-56758927 TTGTGCACTCTGGTTGAATCTGG - Intronic
1010817703 6:80378153-80378175 ATGTGCATAATGGTTGAGATTGG + Intergenic
1010991353 6:82484157-82484179 CTGTGCACAATGATTCAGATGGG - Intergenic
1011784920 6:90832895-90832917 TTATACACAATGGTTTAGATAGG + Intergenic
1014791291 6:125675321-125675343 TTGTGTACAGTGGGTGTGTTGGG - Intergenic
1018450624 6:163903847-163903869 TTGTGCAATTTGCTTGAGTTTGG + Intergenic
1020348401 7:7190171-7190193 TTTTGGAGAATGGTGGAGTTTGG + Intronic
1021150573 7:17146033-17146055 TTTTGCACAATGCAGGAGTTGGG + Intergenic
1029020554 7:97360286-97360308 TGGTGTACAAAGGTTAAGTTTGG - Intergenic
1030671876 7:112346958-112346980 TTTTGGACAATGGTTGCTTTTGG + Intergenic
1033361130 7:140639952-140639974 TTGTCCCCAAGGGTGGAGTTGGG - Intronic
1035985690 8:4429435-4429457 TTGTGAACAGTGGCTCAGTTTGG + Intronic
1036753783 8:11459315-11459337 ATGGTCACAATGGTGGAGTTGGG - Intronic
1041235053 8:55792569-55792591 TTGTGAACTATGGTTGACTATGG + Intronic
1041759418 8:61348109-61348131 TTGGGGACAATGGTTGCGTTTGG - Intronic
1044294172 8:90508193-90508215 TTGTTAACAATGGTTTATTTTGG + Intergenic
1044823456 8:96175016-96175038 TTTTCCACAATAGTTGTGTTAGG + Intergenic
1045499645 8:102735272-102735294 TTCTGCACACATGTTGAGTTAGG + Intergenic
1047290663 8:123526939-123526961 TTGTGCAAAATGGCAGAGTTGGG - Intronic
1048185670 8:132238359-132238381 TAGGGCCCAATGGTTCAGTTAGG - Intronic
1052344337 9:27393530-27393552 TTGTGCAAAATGGTAGACCTGGG + Intronic
1060188122 9:121576133-121576155 CTGTGCACGAAGGATGAGTTGGG - Intronic
1186761280 X:12725006-12725028 TTGTGGACAATGGTTATCTTTGG - Intergenic
1188251599 X:27902657-27902679 AAGTGCACAATTGTTGATTTAGG - Intergenic
1188973747 X:36648850-36648872 TTGTGTACAATATTTTAGTTTGG - Intergenic
1189155348 X:38750989-38751011 TTGTTTACAGTGGTTAAGTTTGG - Intergenic
1196350863 X:114727342-114727364 TTGTGAAGAATAGTTGAGGTAGG + Intronic
1196598607 X:117574690-117574712 TTGTGTAAAATGATGGAGTTAGG + Intergenic
1199070865 X:143474120-143474142 TGGAGAAAAATGGTTGAGTTGGG - Intergenic
1201966571 Y:19743027-19743049 TTCTGGAAAATGGTGGAGTTCGG + Intronic