ID: 986194339

View in Genome Browser
Species Human (GRCh38)
Location 5:5524363-5524385
Sequence ATGTGCTTGTAGACGTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986194339_986194341 -2 Left 986194339 5:5524363-5524385 CCCACACACGTCTACAAGCACAT No data
Right 986194341 5:5524384-5524406 ATCTCTGTTCACTCACACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986194339 Original CRISPR ATGTGCTTGTAGACGTGTGT GGG (reversed) Intergenic
No off target data available for this crispr