ID: 986199711

View in Genome Browser
Species Human (GRCh38)
Location 5:5569982-5570004
Sequence CAGCTGTGCTTGGGGCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986199711_986199720 1 Left 986199711 5:5569982-5570004 CCCTGGGGCCCCAAGCACAGCTG No data
Right 986199720 5:5570006-5570028 GGTTCTGGGACCATGTGCCAGGG No data
986199711_986199719 0 Left 986199711 5:5569982-5570004 CCCTGGGGCCCCAAGCACAGCTG No data
Right 986199719 5:5570005-5570027 AGGTTCTGGGACCATGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986199711 Original CRISPR CAGCTGTGCTTGGGGCCCCA GGG (reversed) Intergenic
No off target data available for this crispr