ID: 986199720

View in Genome Browser
Species Human (GRCh38)
Location 5:5570006-5570028
Sequence GGTTCTGGGACCATGTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986199710_986199720 15 Left 986199710 5:5569968-5569990 CCTGTGCTTGTGGGCCCTGGGGC No data
Right 986199720 5:5570006-5570028 GGTTCTGGGACCATGTGCCAGGG No data
986199717_986199720 -9 Left 986199717 5:5569992-5570014 CCAAGCACAGCTGAGGTTCTGGG No data
Right 986199720 5:5570006-5570028 GGTTCTGGGACCATGTGCCAGGG No data
986199714_986199720 -7 Left 986199714 5:5569990-5570012 CCCCAAGCACAGCTGAGGTTCTG No data
Right 986199720 5:5570006-5570028 GGTTCTGGGACCATGTGCCAGGG No data
986199711_986199720 1 Left 986199711 5:5569982-5570004 CCCTGGGGCCCCAAGCACAGCTG No data
Right 986199720 5:5570006-5570028 GGTTCTGGGACCATGTGCCAGGG No data
986199712_986199720 0 Left 986199712 5:5569983-5570005 CCTGGGGCCCCAAGCACAGCTGA No data
Right 986199720 5:5570006-5570028 GGTTCTGGGACCATGTGCCAGGG No data
986199715_986199720 -8 Left 986199715 5:5569991-5570013 CCCAAGCACAGCTGAGGTTCTGG No data
Right 986199720 5:5570006-5570028 GGTTCTGGGACCATGTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986199720 Original CRISPR GGTTCTGGGACCATGTGCCA GGG Intergenic
No off target data available for this crispr