ID: 986201808

View in Genome Browser
Species Human (GRCh38)
Location 5:5586057-5586079
Sequence TGGTGAGTAAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986201807_986201808 -10 Left 986201807 5:5586044-5586066 CCTGCAAATTAAATGGTGAGTAA No data
Right 986201808 5:5586057-5586079 TGGTGAGTAAATGCAAATTGAGG No data
986201804_986201808 4 Left 986201804 5:5586030-5586052 CCCACTTTCAATTACCTGCAAAT No data
Right 986201808 5:5586057-5586079 TGGTGAGTAAATGCAAATTGAGG No data
986201805_986201808 3 Left 986201805 5:5586031-5586053 CCACTTTCAATTACCTGCAAATT No data
Right 986201808 5:5586057-5586079 TGGTGAGTAAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986201808 Original CRISPR TGGTGAGTAAATGCAAATTG AGG Intergenic
No off target data available for this crispr