ID: 986207025

View in Genome Browser
Species Human (GRCh38)
Location 5:5634493-5634515
Sequence CTGGGTCCACCTTATAATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986207024_986207025 -6 Left 986207024 5:5634476-5634498 CCATGCGAGCTGTGGCTCTGGGT No data
Right 986207025 5:5634493-5634515 CTGGGTCCACCTTATAATTTTGG No data
986207020_986207025 7 Left 986207020 5:5634463-5634485 CCAGCTCTCAGGACCATGCGAGC No data
Right 986207025 5:5634493-5634515 CTGGGTCCACCTTATAATTTTGG No data
986207015_986207025 19 Left 986207015 5:5634451-5634473 CCAACCTCCTTCCCAGCTCTCAG No data
Right 986207025 5:5634493-5634515 CTGGGTCCACCTTATAATTTTGG No data
986207019_986207025 8 Left 986207019 5:5634462-5634484 CCCAGCTCTCAGGACCATGCGAG No data
Right 986207025 5:5634493-5634515 CTGGGTCCACCTTATAATTTTGG No data
986207018_986207025 12 Left 986207018 5:5634458-5634480 CCTTCCCAGCTCTCAGGACCATG No data
Right 986207025 5:5634493-5634515 CTGGGTCCACCTTATAATTTTGG No data
986207017_986207025 15 Left 986207017 5:5634455-5634477 CCTCCTTCCCAGCTCTCAGGACC No data
Right 986207025 5:5634493-5634515 CTGGGTCCACCTTATAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986207025 Original CRISPR CTGGGTCCACCTTATAATTT TGG Intergenic
No off target data available for this crispr