ID: 986209495

View in Genome Browser
Species Human (GRCh38)
Location 5:5657345-5657367
Sequence GGTGGGGTTATTGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986209495_986209504 14 Left 986209495 5:5657345-5657367 CCTCAATTTGCAATAACCCCACC No data
Right 986209504 5:5657382-5657404 AGTTGAAAATGGGTATAAGTGGG No data
986209495_986209501 3 Left 986209495 5:5657345-5657367 CCTCAATTTGCAATAACCCCACC No data
Right 986209501 5:5657371-5657393 AAATTGCATGTAGTTGAAAATGG No data
986209495_986209503 13 Left 986209495 5:5657345-5657367 CCTCAATTTGCAATAACCCCACC No data
Right 986209503 5:5657381-5657403 TAGTTGAAAATGGGTATAAGTGG No data
986209495_986209502 4 Left 986209495 5:5657345-5657367 CCTCAATTTGCAATAACCCCACC No data
Right 986209502 5:5657372-5657394 AATTGCATGTAGTTGAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986209495 Original CRISPR GGTGGGGTTATTGCAAATTG AGG (reversed) Intergenic
No off target data available for this crispr