ID: 986211775

View in Genome Browser
Species Human (GRCh38)
Location 5:5680242-5680264
Sequence GAACTCACTCCTTGCACTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986211772_986211775 8 Left 986211772 5:5680211-5680233 CCCAATGAATTCTAATAAATACG No data
Right 986211775 5:5680242-5680264 GAACTCACTCCTTGCACTATTGG No data
986211773_986211775 7 Left 986211773 5:5680212-5680234 CCAATGAATTCTAATAAATACGT No data
Right 986211775 5:5680242-5680264 GAACTCACTCCTTGCACTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986211775 Original CRISPR GAACTCACTCCTTGCACTAT TGG Intergenic
No off target data available for this crispr