ID: 986219719

View in Genome Browser
Species Human (GRCh38)
Location 5:5757079-5757101
Sequence TGCCCCAGCAAAGCAGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986219717_986219719 -9 Left 986219717 5:5757065-5757087 CCAAATATATGTAGTGCCCCAGC No data
Right 986219719 5:5757079-5757101 TGCCCCAGCAAAGCAGGCTGTGG No data
986219716_986219719 0 Left 986219716 5:5757056-5757078 CCTTGCTGTCCAAATATATGTAG No data
Right 986219719 5:5757079-5757101 TGCCCCAGCAAAGCAGGCTGTGG No data
986219715_986219719 5 Left 986219715 5:5757051-5757073 CCTGTCCTTGCTGTCCAAATATA No data
Right 986219719 5:5757079-5757101 TGCCCCAGCAAAGCAGGCTGTGG No data
986219714_986219719 10 Left 986219714 5:5757046-5757068 CCATGCCTGTCCTTGCTGTCCAA No data
Right 986219719 5:5757079-5757101 TGCCCCAGCAAAGCAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986219719 Original CRISPR TGCCCCAGCAAAGCAGGCTG TGG Intergenic
No off target data available for this crispr