ID: 986220171

View in Genome Browser
Species Human (GRCh38)
Location 5:5761835-5761857
Sequence CTTAGCATCTGACGAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986220169_986220171 3 Left 986220169 5:5761809-5761831 CCTTTCCTCATCTTAGTGGTTAT No data
Right 986220171 5:5761835-5761857 CTTAGCATCTGACGAGTGTCTGG No data
986220168_986220171 4 Left 986220168 5:5761808-5761830 CCCTTTCCTCATCTTAGTGGTTA No data
Right 986220171 5:5761835-5761857 CTTAGCATCTGACGAGTGTCTGG No data
986220170_986220171 -2 Left 986220170 5:5761814-5761836 CCTCATCTTAGTGGTTATTTTCT No data
Right 986220171 5:5761835-5761857 CTTAGCATCTGACGAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986220171 Original CRISPR CTTAGCATCTGACGAGTGTC TGG Intergenic
No off target data available for this crispr