ID: 986221004

View in Genome Browser
Species Human (GRCh38)
Location 5:5768630-5768652
Sequence CCAATATGTTAGAACCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986221001_986221004 7 Left 986221001 5:5768600-5768622 CCAAATGTCACTACACAATGTAA No data
Right 986221004 5:5768630-5768652 CCAATATGTTAGAACCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986221004 Original CRISPR CCAATATGTTAGAACCTCCC TGG Intergenic
No off target data available for this crispr