ID: 986221861

View in Genome Browser
Species Human (GRCh38)
Location 5:5775543-5775565
Sequence GTGTGGGCCTGGAGGTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986221852_986221861 -1 Left 986221852 5:5775521-5775543 CCCCAGAGTGACCAGGCAGTCTG No data
Right 986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG No data
986221853_986221861 -2 Left 986221853 5:5775522-5775544 CCCAGAGTGACCAGGCAGTCTGT No data
Right 986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG No data
986221854_986221861 -3 Left 986221854 5:5775523-5775545 CCAGAGTGACCAGGCAGTCTGTG No data
Right 986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986221861 Original CRISPR GTGTGGGCCTGGAGGTAAGA GGG Intergenic
No off target data available for this crispr