ID: 986223728

View in Genome Browser
Species Human (GRCh38)
Location 5:5793764-5793786
Sequence GACCTTCAGGACCTTGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986223728_986223732 -6 Left 986223728 5:5793764-5793786 CCTTCACCAAGGTCCTGAAGGTC No data
Right 986223732 5:5793781-5793803 AAGGTCAGGAGTCTCTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986223728 Original CRISPR GACCTTCAGGACCTTGGTGA AGG (reversed) Intergenic
No off target data available for this crispr