ID: 986226639

View in Genome Browser
Species Human (GRCh38)
Location 5:5821729-5821751
Sequence CTACATATATTGTCACTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986226639_986226645 9 Left 986226639 5:5821729-5821751 CCCTGCAGTGACAATATATGTAG No data
Right 986226645 5:5821761-5821783 GACTCAATTACTTCTAAGGGAGG No data
986226639_986226644 6 Left 986226639 5:5821729-5821751 CCCTGCAGTGACAATATATGTAG No data
Right 986226644 5:5821758-5821780 ATGGACTCAATTACTTCTAAGGG No data
986226639_986226646 14 Left 986226639 5:5821729-5821751 CCCTGCAGTGACAATATATGTAG No data
Right 986226646 5:5821766-5821788 AATTACTTCTAAGGGAGGATAGG No data
986226639_986226643 5 Left 986226639 5:5821729-5821751 CCCTGCAGTGACAATATATGTAG No data
Right 986226643 5:5821757-5821779 AATGGACTCAATTACTTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986226639 Original CRISPR CTACATATATTGTCACTGCA GGG (reversed) Intergenic
No off target data available for this crispr