ID: 986228605

View in Genome Browser
Species Human (GRCh38)
Location 5:5840805-5840827
Sequence CCATAGGCATGAAGGGATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986228595_986228605 15 Left 986228595 5:5840767-5840789 CCAGGTCTGATGCAACGGTCGAG No data
Right 986228605 5:5840805-5840827 CCATAGGCATGAAGGGATAAGGG No data
986228594_986228605 16 Left 986228594 5:5840766-5840788 CCCAGGTCTGATGCAACGGTCGA No data
Right 986228605 5:5840805-5840827 CCATAGGCATGAAGGGATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986228605 Original CRISPR CCATAGGCATGAAGGGATAA GGG Intergenic
No off target data available for this crispr