ID: 986230504

View in Genome Browser
Species Human (GRCh38)
Location 5:5860408-5860430
Sequence CAGGGTCCAAGGAGGGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986230496_986230504 7 Left 986230496 5:5860378-5860400 CCATGATGGCACCTGTAACTGTG No data
Right 986230504 5:5860408-5860430 CAGGGTCCAAGGAGGGAAACAGG No data
986230498_986230504 -4 Left 986230498 5:5860389-5860411 CCTGTAACTGTGGATCAGTCAGG No data
Right 986230504 5:5860408-5860430 CAGGGTCCAAGGAGGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986230504 Original CRISPR CAGGGTCCAAGGAGGGAAAC AGG Intergenic
No off target data available for this crispr