ID: 986232566

View in Genome Browser
Species Human (GRCh38)
Location 5:5880027-5880049
Sequence CGTTGTATGCACATGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986232562_986232566 -5 Left 986232562 5:5880009-5880031 CCCGTCTTAGCCAGATCACGTTG No data
Right 986232566 5:5880027-5880049 CGTTGTATGCACATGAAGCTGGG No data
986232558_986232566 30 Left 986232558 5:5879974-5879996 CCATTAGCCTGGAATGCTCTCCT No data
Right 986232566 5:5880027-5880049 CGTTGTATGCACATGAAGCTGGG No data
986232560_986232566 23 Left 986232560 5:5879981-5880003 CCTGGAATGCTCTCCTGGCTTTA No data
Right 986232566 5:5880027-5880049 CGTTGTATGCACATGAAGCTGGG No data
986232563_986232566 -6 Left 986232563 5:5880010-5880032 CCGTCTTAGCCAGATCACGTTGT No data
Right 986232566 5:5880027-5880049 CGTTGTATGCACATGAAGCTGGG No data
986232561_986232566 10 Left 986232561 5:5879994-5880016 CCTGGCTTTATAAATCCCGTCTT No data
Right 986232566 5:5880027-5880049 CGTTGTATGCACATGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986232566 Original CRISPR CGTTGTATGCACATGAAGCT GGG Intergenic
No off target data available for this crispr