ID: 986232583

View in Genome Browser
Species Human (GRCh38)
Location 5:5880242-5880264
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986232579_986232583 -7 Left 986232579 5:5880226-5880248 CCACATGAGAGGGCATGTTACAT No data
Right 986232583 5:5880242-5880264 GTTACATGCCACTGCGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr