ID: 986232885

View in Genome Browser
Species Human (GRCh38)
Location 5:5883308-5883330
Sequence CTTCTTTTTCAGATGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986232885_986232892 16 Left 986232885 5:5883308-5883330 CCAAGCTCCATCTGAAAAAGAAG No data
Right 986232892 5:5883347-5883369 GGGACATCAGCTGGTCTGGAAGG No data
986232885_986232889 7 Left 986232885 5:5883308-5883330 CCAAGCTCCATCTGAAAAAGAAG No data
Right 986232889 5:5883338-5883360 AGCCAATCTGGGACATCAGCTGG No data
986232885_986232888 -4 Left 986232885 5:5883308-5883330 CCAAGCTCCATCTGAAAAAGAAG No data
Right 986232888 5:5883327-5883349 GAAGCTTTCTGAGCCAATCTGGG No data
986232885_986232891 12 Left 986232885 5:5883308-5883330 CCAAGCTCCATCTGAAAAAGAAG No data
Right 986232891 5:5883343-5883365 ATCTGGGACATCAGCTGGTCTGG No data
986232885_986232895 26 Left 986232885 5:5883308-5883330 CCAAGCTCCATCTGAAAAAGAAG No data
Right 986232895 5:5883357-5883379 CTGGTCTGGAAGGCTCTGGGTGG No data
986232885_986232896 27 Left 986232885 5:5883308-5883330 CCAAGCTCCATCTGAAAAAGAAG No data
Right 986232896 5:5883358-5883380 TGGTCTGGAAGGCTCTGGGTGGG No data
986232885_986232893 22 Left 986232885 5:5883308-5883330 CCAAGCTCCATCTGAAAAAGAAG No data
Right 986232893 5:5883353-5883375 TCAGCTGGTCTGGAAGGCTCTGG No data
986232885_986232887 -5 Left 986232885 5:5883308-5883330 CCAAGCTCCATCTGAAAAAGAAG No data
Right 986232887 5:5883326-5883348 AGAAGCTTTCTGAGCCAATCTGG No data
986232885_986232894 23 Left 986232885 5:5883308-5883330 CCAAGCTCCATCTGAAAAAGAAG No data
Right 986232894 5:5883354-5883376 CAGCTGGTCTGGAAGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986232885 Original CRISPR CTTCTTTTTCAGATGGAGCT TGG (reversed) Intergenic
No off target data available for this crispr