ID: 986233242

View in Genome Browser
Species Human (GRCh38)
Location 5:5885745-5885767
Sequence GACAGTGACCAGGGCCTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986233237_986233242 9 Left 986233237 5:5885713-5885735 CCTTCCATTGGTGCAGAAGCAAC No data
Right 986233242 5:5885745-5885767 GACAGTGACCAGGGCCTTGGTGG No data
986233238_986233242 5 Left 986233238 5:5885717-5885739 CCATTGGTGCAGAAGCAACAGTA No data
Right 986233242 5:5885745-5885767 GACAGTGACCAGGGCCTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986233242 Original CRISPR GACAGTGACCAGGGCCTTGG TGG Intergenic
No off target data available for this crispr