ID: 986233275

View in Genome Browser
Species Human (GRCh38)
Location 5:5885851-5885873
Sequence CTAAGGGACAGTTGCACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986233275_986233279 0 Left 986233275 5:5885851-5885873 CCCTTTGTGCAACTGTCCCTTAG No data
Right 986233279 5:5885874-5885896 CATCCACTCCATCAGCCTTCTGG No data
986233275_986233280 1 Left 986233275 5:5885851-5885873 CCCTTTGTGCAACTGTCCCTTAG No data
Right 986233280 5:5885875-5885897 ATCCACTCCATCAGCCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986233275 Original CRISPR CTAAGGGACAGTTGCACAAA GGG (reversed) Intergenic
No off target data available for this crispr