ID: 986233282

View in Genome Browser
Species Human (GRCh38)
Location 5:5885882-5885904
Sequence GTGGTGGCCCAGAAGGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986233282_986233291 20 Left 986233282 5:5885882-5885904 CCATCAGCCTTCTGGGCCACCAC No data
Right 986233291 5:5885925-5885947 GATGCCAGCAGCAGCTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986233282 Original CRISPR GTGGTGGCCCAGAAGGCTGA TGG (reversed) Intergenic
No off target data available for this crispr