ID: 986233291

View in Genome Browser
Species Human (GRCh38)
Location 5:5885925-5885947
Sequence GATGCCAGCAGCAGCTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986233283_986233291 13 Left 986233283 5:5885889-5885911 CCTTCTGGGCCACCACAACCAGA No data
Right 986233291 5:5885925-5885947 GATGCCAGCAGCAGCTGCAGTGG No data
986233281_986233291 25 Left 986233281 5:5885877-5885899 CCACTCCATCAGCCTTCTGGGCC No data
Right 986233291 5:5885925-5885947 GATGCCAGCAGCAGCTGCAGTGG No data
986233286_986233291 -5 Left 986233286 5:5885907-5885929 CCAGAGCACCCAAACCCAGATGC No data
Right 986233291 5:5885925-5885947 GATGCCAGCAGCAGCTGCAGTGG No data
986233284_986233291 4 Left 986233284 5:5885898-5885920 CCACCACAACCAGAGCACCCAAA No data
Right 986233291 5:5885925-5885947 GATGCCAGCAGCAGCTGCAGTGG No data
986233285_986233291 1 Left 986233285 5:5885901-5885923 CCACAACCAGAGCACCCAAACCC No data
Right 986233291 5:5885925-5885947 GATGCCAGCAGCAGCTGCAGTGG No data
986233282_986233291 20 Left 986233282 5:5885882-5885904 CCATCAGCCTTCTGGGCCACCAC No data
Right 986233291 5:5885925-5885947 GATGCCAGCAGCAGCTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986233291 Original CRISPR GATGCCAGCAGCAGCTGCAG TGG Intergenic
No off target data available for this crispr