ID: 986235425

View in Genome Browser
Species Human (GRCh38)
Location 5:5905264-5905286
Sequence ATCCTATACCAGTCAGGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986235422_986235425 10 Left 986235422 5:5905231-5905253 CCAAACTGCTCTTGTAATCTTGT No data
Right 986235425 5:5905264-5905286 ATCCTATACCAGTCAGGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986235425 Original CRISPR ATCCTATACCAGTCAGGATA GGG Intergenic
No off target data available for this crispr