ID: 986241426 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:5963417-5963439 |
| Sequence | GAGGGTGAACTGAAGCAGGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 986241421_986241426 | 6 | Left | 986241421 | 5:5963388-5963410 | CCATCTTTCAACAAGAAGTGATA | No data | ||
| Right | 986241426 | 5:5963417-5963439 | GAGGGTGAACTGAAGCAGGCAGG | No data | ||||
| 986241420_986241426 | 22 | Left | 986241420 | 5:5963372-5963394 | CCAACACTTGTTGTAACCATCTT | No data | ||
| Right | 986241426 | 5:5963417-5963439 | GAGGGTGAACTGAAGCAGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 986241426 | Original CRISPR | GAGGGTGAACTGAAGCAGGC AGG | Intergenic | ||
| No off target data available for this crispr | |||||