ID: 986241426

View in Genome Browser
Species Human (GRCh38)
Location 5:5963417-5963439
Sequence GAGGGTGAACTGAAGCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986241421_986241426 6 Left 986241421 5:5963388-5963410 CCATCTTTCAACAAGAAGTGATA No data
Right 986241426 5:5963417-5963439 GAGGGTGAACTGAAGCAGGCAGG No data
986241420_986241426 22 Left 986241420 5:5963372-5963394 CCAACACTTGTTGTAACCATCTT No data
Right 986241426 5:5963417-5963439 GAGGGTGAACTGAAGCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986241426 Original CRISPR GAGGGTGAACTGAAGCAGGC AGG Intergenic
No off target data available for this crispr