ID: 986250147

View in Genome Browser
Species Human (GRCh38)
Location 5:6048138-6048160
Sequence GGAGGTGGTGGTTACTCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986250144_986250147 -7 Left 986250144 5:6048122-6048144 CCATTTAAATGGTTGAGGAGGTG No data
Right 986250147 5:6048138-6048160 GGAGGTGGTGGTTACTCTAATGG No data
986250140_986250147 16 Left 986250140 5:6048099-6048121 CCAGAAAGCTTGCAGTCTGCAAA No data
Right 986250147 5:6048138-6048160 GGAGGTGGTGGTTACTCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986250147 Original CRISPR GGAGGTGGTGGTTACTCTAA TGG Intergenic
No off target data available for this crispr