ID: 986252046

View in Genome Browser
Species Human (GRCh38)
Location 5:6068979-6069001
Sequence CCTCCCATCCTCATTCCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986252046_986252049 -7 Left 986252046 5:6068979-6069001 CCCATAGGAATGAGGATGGGAGG No data
Right 986252049 5:6068995-6069017 TGGGAGGACCTCCAATTAACAGG No data
986252046_986252050 -6 Left 986252046 5:6068979-6069001 CCCATAGGAATGAGGATGGGAGG No data
Right 986252050 5:6068996-6069018 GGGAGGACCTCCAATTAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986252046 Original CRISPR CCTCCCATCCTCATTCCTAT GGG (reversed) Intergenic
No off target data available for this crispr