ID: 986254351

View in Genome Browser
Species Human (GRCh38)
Location 5:6089358-6089380
Sequence CTCTGTACACCAATGTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986254342_986254351 21 Left 986254342 5:6089314-6089336 CCAATGCTCTCGGTTGCCCCCGT No data
Right 986254351 5:6089358-6089380 CTCTGTACACCAATGTTCTGTGG No data
986254344_986254351 5 Left 986254344 5:6089330-6089352 CCCCCGTCTGTGGCCTATAATGC No data
Right 986254351 5:6089358-6089380 CTCTGTACACCAATGTTCTGTGG No data
986254345_986254351 4 Left 986254345 5:6089331-6089353 CCCCGTCTGTGGCCTATAATGCC No data
Right 986254351 5:6089358-6089380 CTCTGTACACCAATGTTCTGTGG No data
986254348_986254351 -8 Left 986254348 5:6089343-6089365 CCTATAATGCCACACCTCTGTAC No data
Right 986254351 5:6089358-6089380 CTCTGTACACCAATGTTCTGTGG No data
986254347_986254351 2 Left 986254347 5:6089333-6089355 CCGTCTGTGGCCTATAATGCCAC No data
Right 986254351 5:6089358-6089380 CTCTGTACACCAATGTTCTGTGG No data
986254341_986254351 28 Left 986254341 5:6089307-6089329 CCAGTCTCCAATGCTCTCGGTTG No data
Right 986254351 5:6089358-6089380 CTCTGTACACCAATGTTCTGTGG No data
986254346_986254351 3 Left 986254346 5:6089332-6089354 CCCGTCTGTGGCCTATAATGCCA No data
Right 986254351 5:6089358-6089380 CTCTGTACACCAATGTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986254351 Original CRISPR CTCTGTACACCAATGTTCTG TGG Intergenic
No off target data available for this crispr