ID: 986255633

View in Genome Browser
Species Human (GRCh38)
Location 5:6100567-6100589
Sequence CACATGGACCTCCCCACCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986255622_986255633 11 Left 986255622 5:6100533-6100555 CCCCATGGACGTTCCCATTACAT No data
Right 986255633 5:6100567-6100589 CACATGGACCTCCCCACCTTAGG No data
986255623_986255633 10 Left 986255623 5:6100534-6100556 CCCATGGACGTTCCCATTACATG No data
Right 986255633 5:6100567-6100589 CACATGGACCTCCCCACCTTAGG No data
986255627_986255633 -3 Left 986255627 5:6100547-6100569 CCATTACATGGACCTCCCACCAC No data
Right 986255633 5:6100567-6100589 CACATGGACCTCCCCACCTTAGG No data
986255624_986255633 9 Left 986255624 5:6100535-6100557 CCATGGACGTTCCCATTACATGG No data
Right 986255633 5:6100567-6100589 CACATGGACCTCCCCACCTTAGG No data
986255626_986255633 -2 Left 986255626 5:6100546-6100568 CCCATTACATGGACCTCCCACCA No data
Right 986255633 5:6100567-6100589 CACATGGACCTCCCCACCTTAGG No data
986255619_986255633 19 Left 986255619 5:6100525-6100547 CCTTCCCACCCCATGGACGTTCC No data
Right 986255633 5:6100567-6100589 CACATGGACCTCCCCACCTTAGG No data
986255621_986255633 14 Left 986255621 5:6100530-6100552 CCACCCCATGGACGTTCCCATTA No data
Right 986255633 5:6100567-6100589 CACATGGACCTCCCCACCTTAGG No data
986255620_986255633 15 Left 986255620 5:6100529-6100551 CCCACCCCATGGACGTTCCCATT No data
Right 986255633 5:6100567-6100589 CACATGGACCTCCCCACCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986255633 Original CRISPR CACATGGACCTCCCCACCTT AGG Intergenic
No off target data available for this crispr