ID: 986264217

View in Genome Browser
Species Human (GRCh38)
Location 5:6179018-6179040
Sequence CACAGCTCAGGGCCCTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986264211_986264217 24 Left 986264211 5:6178971-6178993 CCAAGGGCATGCTGGGAGAGTCT No data
Right 986264217 5:6179018-6179040 CACAGCTCAGGGCCCTCCCTGGG No data
986264212_986264217 -6 Left 986264212 5:6179001-6179023 CCTGCAGTGACATCCAGCACAGC No data
Right 986264217 5:6179018-6179040 CACAGCTCAGGGCCCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986264217 Original CRISPR CACAGCTCAGGGCCCTCCCT GGG Intergenic