ID: 986264217 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:6179018-6179040 |
Sequence | CACAGCTCAGGGCCCTCCCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
986264211_986264217 | 24 | Left | 986264211 | 5:6178971-6178993 | CCAAGGGCATGCTGGGAGAGTCT | No data | ||
Right | 986264217 | 5:6179018-6179040 | CACAGCTCAGGGCCCTCCCTGGG | No data | ||||
986264212_986264217 | -6 | Left | 986264212 | 5:6179001-6179023 | CCTGCAGTGACATCCAGCACAGC | No data | ||
Right | 986264217 | 5:6179018-6179040 | CACAGCTCAGGGCCCTCCCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
986264217 | Original CRISPR | CACAGCTCAGGGCCCTCCCT GGG | Intergenic | ||