ID: 986266150

View in Genome Browser
Species Human (GRCh38)
Location 5:6193057-6193079
Sequence AGGAAGCAGAATTGCCTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986266150_986266155 27 Left 986266150 5:6193057-6193079 CCTGACAGGCAATTCTGCTTCCT No data
Right 986266155 5:6193107-6193129 TACCGCCCTCTCTAAATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986266150 Original CRISPR AGGAAGCAGAATTGCCTGTC AGG (reversed) Intergenic
No off target data available for this crispr