ID: 986266633

View in Genome Browser
Species Human (GRCh38)
Location 5:6196703-6196725
Sequence ATGTAGAGGCAGCAAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986266629_986266633 6 Left 986266629 5:6196674-6196696 CCAAGGATGCTCAGCAGGGGAAA No data
Right 986266633 5:6196703-6196725 ATGTAGAGGCAGCAAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986266633 Original CRISPR ATGTAGAGGCAGCAAGAGGA TGG Intergenic
No off target data available for this crispr