ID: 986266844

View in Genome Browser
Species Human (GRCh38)
Location 5:6198015-6198037
Sequence CTGGTGAGCAGAAGTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986266844_986266853 9 Left 986266844 5:6198015-6198037 CCAGACACACTTCTGCTCACCAG No data
Right 986266853 5:6198047-6198069 CGCATAGGGTCCACAGATGGGGG No data
986266844_986266850 6 Left 986266844 5:6198015-6198037 CCAGACACACTTCTGCTCACCAG No data
Right 986266850 5:6198044-6198066 CAGCGCATAGGGTCCACAGATGG No data
986266844_986266851 7 Left 986266844 5:6198015-6198037 CCAGACACACTTCTGCTCACCAG No data
Right 986266851 5:6198045-6198067 AGCGCATAGGGTCCACAGATGGG No data
986266844_986266852 8 Left 986266844 5:6198015-6198037 CCAGACACACTTCTGCTCACCAG No data
Right 986266852 5:6198046-6198068 GCGCATAGGGTCCACAGATGGGG No data
986266844_986266854 16 Left 986266844 5:6198015-6198037 CCAGACACACTTCTGCTCACCAG No data
Right 986266854 5:6198054-6198076 GGTCCACAGATGGGGGATCAAGG No data
986266844_986266845 -6 Left 986266844 5:6198015-6198037 CCAGACACACTTCTGCTCACCAG No data
Right 986266845 5:6198032-6198054 CACCAGATGTCCCAGCGCATAGG No data
986266844_986266846 -5 Left 986266844 5:6198015-6198037 CCAGACACACTTCTGCTCACCAG No data
Right 986266846 5:6198033-6198055 ACCAGATGTCCCAGCGCATAGGG No data
986266844_986266856 20 Left 986266844 5:6198015-6198037 CCAGACACACTTCTGCTCACCAG No data
Right 986266856 5:6198058-6198080 CACAGATGGGGGATCAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986266844 Original CRISPR CTGGTGAGCAGAAGTGTGTC TGG (reversed) Intergenic
No off target data available for this crispr