ID: 986267320

View in Genome Browser
Species Human (GRCh38)
Location 5:6201792-6201814
Sequence AAACCCTGCAGCTCAAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986267315_986267320 11 Left 986267315 5:6201758-6201780 CCAGTCTCTTTCCTTAGCATCTT No data
Right 986267320 5:6201792-6201814 AAACCCTGCAGCTCAAAGAGAGG No data
986267314_986267320 25 Left 986267314 5:6201744-6201766 CCTGAGAAGAAGGTCCAGTCTCT No data
Right 986267320 5:6201792-6201814 AAACCCTGCAGCTCAAAGAGAGG No data
986267319_986267320 0 Left 986267319 5:6201769-6201791 CCTTAGCATCTTCGGGCTGGTAG No data
Right 986267320 5:6201792-6201814 AAACCCTGCAGCTCAAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986267320 Original CRISPR AAACCCTGCAGCTCAAAGAG AGG Intergenic