ID: 986268609

View in Genome Browser
Species Human (GRCh38)
Location 5:6211845-6211867
Sequence CAGGGCCACCTGGAGTCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986268597_986268609 12 Left 986268597 5:6211810-6211832 CCGTATTAGGCTGATGCCCAGGG No data
Right 986268609 5:6211845-6211867 CAGGGCCACCTGGAGTCATGGGG No data
986268593_986268609 24 Left 986268593 5:6211798-6211820 CCACAGACAGCCCCGTATTAGGC No data
Right 986268609 5:6211845-6211867 CAGGGCCACCTGGAGTCATGGGG No data
986268603_986268609 -5 Left 986268603 5:6211827-6211849 CCAGGGAAGCCATGGAGGCAGGG No data
Right 986268609 5:6211845-6211867 CAGGGCCACCTGGAGTCATGGGG No data
986268591_986268609 27 Left 986268591 5:6211795-6211817 CCACCACAGACAGCCCCGTATTA No data
Right 986268609 5:6211845-6211867 CAGGGCCACCTGGAGTCATGGGG No data
986268595_986268609 13 Left 986268595 5:6211809-6211831 CCCGTATTAGGCTGATGCCCAGG No data
Right 986268609 5:6211845-6211867 CAGGGCCACCTGGAGTCATGGGG No data
986268601_986268609 -4 Left 986268601 5:6211826-6211848 CCCAGGGAAGCCATGGAGGCAGG No data
Right 986268609 5:6211845-6211867 CAGGGCCACCTGGAGTCATGGGG No data
986268594_986268609 14 Left 986268594 5:6211808-6211830 CCCCGTATTAGGCTGATGCCCAG No data
Right 986268609 5:6211845-6211867 CAGGGCCACCTGGAGTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986268609 Original CRISPR CAGGGCCACCTGGAGTCATG GGG Intergenic
No off target data available for this crispr