ID: 986268700

View in Genome Browser
Species Human (GRCh38)
Location 5:6212544-6212566
Sequence CACCAGACACTGCATCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986268697_986268700 -8 Left 986268697 5:6212529-6212551 CCAGGAAATGGCCCTCACCAGAC No data
Right 986268700 5:6212544-6212566 CACCAGACACTGCATCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986268700 Original CRISPR CACCAGACACTGCATCAGCC AGG Intergenic
No off target data available for this crispr