ID: 986270812

View in Genome Browser
Species Human (GRCh38)
Location 5:6229048-6229070
Sequence CTGTGGGACTGTTGGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986270802_986270812 15 Left 986270802 5:6229010-6229032 CCACCAGTCATTTTTCTTTGATG No data
Right 986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG No data
986270801_986270812 16 Left 986270801 5:6229009-6229031 CCCACCAGTCATTTTTCTTTGAT No data
Right 986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG No data
986270799_986270812 18 Left 986270799 5:6229007-6229029 CCCCCACCAGTCATTTTTCTTTG No data
Right 986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG No data
986270800_986270812 17 Left 986270800 5:6229008-6229030 CCCCACCAGTCATTTTTCTTTGA No data
Right 986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG No data
986270803_986270812 12 Left 986270803 5:6229013-6229035 CCAGTCATTTTTCTTTGATGTGG No data
Right 986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986270812 Original CRISPR CTGTGGGACTGTTGGGAAGT TGG Intergenic
No off target data available for this crispr