ID: 986273205

View in Genome Browser
Species Human (GRCh38)
Location 5:6251981-6252003
Sequence AAGTGTGACCAGGGCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986273205_986273214 26 Left 986273205 5:6251981-6252003 CCCACAGTGCCCTGGTCACACTT No data
Right 986273214 5:6252030-6252052 TAAATCTACTTTTTGCCAGTAGG No data
986273205_986273212 1 Left 986273205 5:6251981-6252003 CCCACAGTGCCCTGGTCACACTT No data
Right 986273212 5:6252005-6252027 GGCTGGGCCATCTTATTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986273205 Original CRISPR AAGTGTGACCAGGGCACTGT GGG (reversed) Intergenic
No off target data available for this crispr