ID: 986277824

View in Genome Browser
Species Human (GRCh38)
Location 5:6295609-6295631
Sequence ATTTCACTAGACATGCATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986277824_986277825 -4 Left 986277824 5:6295609-6295631 CCACTATGCATGTCTAGTGAAAT No data
Right 986277825 5:6295628-6295650 AAATTGAACGATTAAATAAATGG No data
986277824_986277827 7 Left 986277824 5:6295609-6295631 CCACTATGCATGTCTAGTGAAAT No data
Right 986277827 5:6295639-6295661 TTAAATAAATGGATGGTGAATGG No data
986277824_986277828 11 Left 986277824 5:6295609-6295631 CCACTATGCATGTCTAGTGAAAT No data
Right 986277828 5:6295643-6295665 ATAAATGGATGGTGAATGGTAGG No data
986277824_986277826 0 Left 986277824 5:6295609-6295631 CCACTATGCATGTCTAGTGAAAT No data
Right 986277826 5:6295632-6295654 TGAACGATTAAATAAATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986277824 Original CRISPR ATTTCACTAGACATGCATAG TGG (reversed) Intergenic
No off target data available for this crispr