ID: 986277824 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:6295609-6295631 |
Sequence | ATTTCACTAGACATGCATAG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
986277824_986277825 | -4 | Left | 986277824 | 5:6295609-6295631 | CCACTATGCATGTCTAGTGAAAT | No data | ||
Right | 986277825 | 5:6295628-6295650 | AAATTGAACGATTAAATAAATGG | No data | ||||
986277824_986277827 | 7 | Left | 986277824 | 5:6295609-6295631 | CCACTATGCATGTCTAGTGAAAT | No data | ||
Right | 986277827 | 5:6295639-6295661 | TTAAATAAATGGATGGTGAATGG | No data | ||||
986277824_986277828 | 11 | Left | 986277824 | 5:6295609-6295631 | CCACTATGCATGTCTAGTGAAAT | No data | ||
Right | 986277828 | 5:6295643-6295665 | ATAAATGGATGGTGAATGGTAGG | No data | ||||
986277824_986277826 | 0 | Left | 986277824 | 5:6295609-6295631 | CCACTATGCATGTCTAGTGAAAT | No data | ||
Right | 986277826 | 5:6295632-6295654 | TGAACGATTAAATAAATGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
986277824 | Original CRISPR | ATTTCACTAGACATGCATAG TGG (reversed) | Intergenic | ||
No off target data available for this crispr |