ID: 986277827

View in Genome Browser
Species Human (GRCh38)
Location 5:6295639-6295661
Sequence TTAAATAAATGGATGGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986277824_986277827 7 Left 986277824 5:6295609-6295631 CCACTATGCATGTCTAGTGAAAT No data
Right 986277827 5:6295639-6295661 TTAAATAAATGGATGGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986277827 Original CRISPR TTAAATAAATGGATGGTGAA TGG Intergenic
No off target data available for this crispr