ID: 986278904

View in Genome Browser
Species Human (GRCh38)
Location 5:6306505-6306527
Sequence TAAACCATAGGGTCTTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986278904_986278915 1 Left 986278904 5:6306505-6306527 CCTCCACAAGACCCTATGGTTTA No data
Right 986278915 5:6306529-6306551 TAGGAGATGGGGGGCTAGGCAGG No data
986278904_986278914 -3 Left 986278904 5:6306505-6306527 CCTCCACAAGACCCTATGGTTTA No data
Right 986278914 5:6306525-6306547 TTATTAGGAGATGGGGGGCTAGG No data
986278904_986278913 -8 Left 986278904 5:6306505-6306527 CCTCCACAAGACCCTATGGTTTA No data
Right 986278913 5:6306520-6306542 ATGGTTTATTAGGAGATGGGGGG No data
986278904_986278912 -9 Left 986278904 5:6306505-6306527 CCTCCACAAGACCCTATGGTTTA No data
Right 986278912 5:6306519-6306541 TATGGTTTATTAGGAGATGGGGG No data
986278904_986278911 -10 Left 986278904 5:6306505-6306527 CCTCCACAAGACCCTATGGTTTA No data
Right 986278911 5:6306518-6306540 CTATGGTTTATTAGGAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986278904 Original CRISPR TAAACCATAGGGTCTTGTGG AGG (reversed) Intergenic
No off target data available for this crispr