ID: 986286193

View in Genome Browser
Species Human (GRCh38)
Location 5:6360826-6360848
Sequence GGCCTGGATTTCCATTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986286193_986286196 -7 Left 986286193 5:6360826-6360848 CCCAGTGAATGGAAATCCAGGCC No data
Right 986286196 5:6360842-6360864 CCAGGCCATCCTCATCCTGAAGG No data
986286193_986286199 5 Left 986286193 5:6360826-6360848 CCCAGTGAATGGAAATCCAGGCC No data
Right 986286199 5:6360854-6360876 CATCCTGAAGGTGCCAGAGCAGG No data
986286193_986286201 14 Left 986286193 5:6360826-6360848 CCCAGTGAATGGAAATCCAGGCC No data
Right 986286201 5:6360863-6360885 GGTGCCAGAGCAGGCCCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986286193 Original CRISPR GGCCTGGATTTCCATTCACT GGG (reversed) Intergenic
No off target data available for this crispr