ID: 986286901

View in Genome Browser
Species Human (GRCh38)
Location 5:6365779-6365801
Sequence TGCTCCATCCACTTTGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986286901_986286905 6 Left 986286901 5:6365779-6365801 CCAGTATCAAAGTGGATGGAGCA No data
Right 986286905 5:6365808-6365830 TGTGAGTCACAGGATGCTGCTGG No data
986286901_986286904 -4 Left 986286901 5:6365779-6365801 CCAGTATCAAAGTGGATGGAGCA No data
Right 986286904 5:6365798-6365820 AGCACAGGGCTGTGAGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986286901 Original CRISPR TGCTCCATCCACTTTGATAC TGG (reversed) Intergenic
No off target data available for this crispr