ID: 986287525

View in Genome Browser
Species Human (GRCh38)
Location 5:6370843-6370865
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986287525_986287527 -5 Left 986287525 5:6370843-6370865 CCTCTACTCTAGCAGAAATTCTT No data
Right 986287527 5:6370861-6370883 TTCTTCCCCTTGGTAGCAGTAGG No data
986287525_986287531 8 Left 986287525 5:6370843-6370865 CCTCTACTCTAGCAGAAATTCTT No data
Right 986287531 5:6370874-6370896 TAGCAGTAGGAGTCCTTTTCTGG No data
986287525_986287532 19 Left 986287525 5:6370843-6370865 CCTCTACTCTAGCAGAAATTCTT No data
Right 986287532 5:6370885-6370907 GTCCTTTTCTGGTGCTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986287525 Original CRISPR AAGAATTTCTGCTAGAGTAG AGG (reversed) Intergenic
No off target data available for this crispr