ID: 986287527

View in Genome Browser
Species Human (GRCh38)
Location 5:6370861-6370883
Sequence TTCTTCCCCTTGGTAGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986287524_986287527 -2 Left 986287524 5:6370840-6370862 CCTCCTCTACTCTAGCAGAAATT No data
Right 986287527 5:6370861-6370883 TTCTTCCCCTTGGTAGCAGTAGG No data
986287525_986287527 -5 Left 986287525 5:6370843-6370865 CCTCTACTCTAGCAGAAATTCTT No data
Right 986287527 5:6370861-6370883 TTCTTCCCCTTGGTAGCAGTAGG No data
986287521_986287527 17 Left 986287521 5:6370821-6370843 CCGAACCTGCCAGCAGGGGCCTC No data
Right 986287527 5:6370861-6370883 TTCTTCCCCTTGGTAGCAGTAGG No data
986287520_986287527 18 Left 986287520 5:6370820-6370842 CCCGAACCTGCCAGCAGGGGCCT No data
Right 986287527 5:6370861-6370883 TTCTTCCCCTTGGTAGCAGTAGG No data
986287522_986287527 12 Left 986287522 5:6370826-6370848 CCTGCCAGCAGGGGCCTCCTCTA No data
Right 986287527 5:6370861-6370883 TTCTTCCCCTTGGTAGCAGTAGG No data
986287523_986287527 8 Left 986287523 5:6370830-6370852 CCAGCAGGGGCCTCCTCTACTCT No data
Right 986287527 5:6370861-6370883 TTCTTCCCCTTGGTAGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986287527 Original CRISPR TTCTTCCCCTTGGTAGCAGT AGG Intergenic
No off target data available for this crispr