ID: 986287528

View in Genome Browser
Species Human (GRCh38)
Location 5:6370866-6370888
Sequence GGACTCCTACTGCTACCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986287528_986287535 20 Left 986287528 5:6370866-6370888 CCCCTTGGTAGCAGTAGGAGTCC No data
Right 986287535 5:6370909-6370931 GAGAACAGAACTGCTAGCGAGGG No data
986287528_986287534 19 Left 986287528 5:6370866-6370888 CCCCTTGGTAGCAGTAGGAGTCC No data
Right 986287534 5:6370908-6370930 AGAGAACAGAACTGCTAGCGAGG No data
986287528_986287532 -4 Left 986287528 5:6370866-6370888 CCCCTTGGTAGCAGTAGGAGTCC No data
Right 986287532 5:6370885-6370907 GTCCTTTTCTGGTGCTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986287528 Original CRISPR GGACTCCTACTGCTACCAAG GGG (reversed) Intergenic
No off target data available for this crispr