ID: 986287529

View in Genome Browser
Species Human (GRCh38)
Location 5:6370867-6370889
Sequence AGGACTCCTACTGCTACCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986287529_986287534 18 Left 986287529 5:6370867-6370889 CCCTTGGTAGCAGTAGGAGTCCT No data
Right 986287534 5:6370908-6370930 AGAGAACAGAACTGCTAGCGAGG No data
986287529_986287535 19 Left 986287529 5:6370867-6370889 CCCTTGGTAGCAGTAGGAGTCCT No data
Right 986287535 5:6370909-6370931 GAGAACAGAACTGCTAGCGAGGG No data
986287529_986287532 -5 Left 986287529 5:6370867-6370889 CCCTTGGTAGCAGTAGGAGTCCT No data
Right 986287532 5:6370885-6370907 GTCCTTTTCTGGTGCTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986287529 Original CRISPR AGGACTCCTACTGCTACCAA GGG (reversed) Intergenic
No off target data available for this crispr