ID: 986287530

View in Genome Browser
Species Human (GRCh38)
Location 5:6370868-6370890
Sequence AAGGACTCCTACTGCTACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986287530_986287532 -6 Left 986287530 5:6370868-6370890 CCTTGGTAGCAGTAGGAGTCCTT No data
Right 986287532 5:6370885-6370907 GTCCTTTTCTGGTGCTGTTTTGG No data
986287530_986287534 17 Left 986287530 5:6370868-6370890 CCTTGGTAGCAGTAGGAGTCCTT No data
Right 986287534 5:6370908-6370930 AGAGAACAGAACTGCTAGCGAGG No data
986287530_986287535 18 Left 986287530 5:6370868-6370890 CCTTGGTAGCAGTAGGAGTCCTT No data
Right 986287535 5:6370909-6370931 GAGAACAGAACTGCTAGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986287530 Original CRISPR AAGGACTCCTACTGCTACCA AGG (reversed) Intergenic
No off target data available for this crispr