ID: 986287532

View in Genome Browser
Species Human (GRCh38)
Location 5:6370885-6370907
Sequence GTCCTTTTCTGGTGCTGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986287525_986287532 19 Left 986287525 5:6370843-6370865 CCTCTACTCTAGCAGAAATTCTT No data
Right 986287532 5:6370885-6370907 GTCCTTTTCTGGTGCTGTTTTGG No data
986287530_986287532 -6 Left 986287530 5:6370868-6370890 CCTTGGTAGCAGTAGGAGTCCTT No data
Right 986287532 5:6370885-6370907 GTCCTTTTCTGGTGCTGTTTTGG No data
986287524_986287532 22 Left 986287524 5:6370840-6370862 CCTCCTCTACTCTAGCAGAAATT No data
Right 986287532 5:6370885-6370907 GTCCTTTTCTGGTGCTGTTTTGG No data
986287528_986287532 -4 Left 986287528 5:6370866-6370888 CCCCTTGGTAGCAGTAGGAGTCC No data
Right 986287532 5:6370885-6370907 GTCCTTTTCTGGTGCTGTTTTGG No data
986287529_986287532 -5 Left 986287529 5:6370867-6370889 CCCTTGGTAGCAGTAGGAGTCCT No data
Right 986287532 5:6370885-6370907 GTCCTTTTCTGGTGCTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986287532 Original CRISPR GTCCTTTTCTGGTGCTGTTT TGG Intergenic
No off target data available for this crispr