ID: 986287915

View in Genome Browser
Species Human (GRCh38)
Location 5:6373649-6373671
Sequence AGAGGCACCTATTGTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986287902_986287915 20 Left 986287902 5:6373606-6373628 CCAGAACCGAAAACCAGGCCGGC 0: 1
1: 0
2: 0
3: 5
4: 40
Right 986287915 5:6373649-6373671 AGAGGCACCTATTGTGAGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 133
986287910_986287915 2 Left 986287910 5:6373624-6373646 CCGGCGTGGATGGCCGGGAGGAG 0: 1
1: 0
2: 2
3: 10
4: 127
Right 986287915 5:6373649-6373671 AGAGGCACCTATTGTGAGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 133
986287904_986287915 14 Left 986287904 5:6373612-6373634 CCGAAAACCAGGCCGGCGTGGAT 0: 1
1: 0
2: 0
3: 4
4: 51
Right 986287915 5:6373649-6373671 AGAGGCACCTATTGTGAGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 133
986287907_986287915 7 Left 986287907 5:6373619-6373641 CCAGGCCGGCGTGGATGGCCGGG 0: 1
1: 0
2: 2
3: 481
4: 5528
Right 986287915 5:6373649-6373671 AGAGGCACCTATTGTGAGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986287915 Original CRISPR AGAGGCACCTATTGTGAGCT GGG Intronic
902593876 1:17494711-17494733 AGAGGCACCGCTTGCTAGCTGGG + Intergenic
902940818 1:19799439-19799461 ACAGGGACCTCTTGTGACCTTGG + Intronic
906972413 1:50529983-50530005 AAAGGCACCTATGGTGTGGTTGG + Intronic
907269038 1:53279870-53279892 AGGGGCACCTACTGTGTGCCAGG - Intronic
908741154 1:67328988-67329010 AGAAGCACATAGTGTGAGGTTGG - Intronic
909349951 1:74639956-74639978 AGGGATACCTATTGTGATCTTGG - Intronic
912310617 1:108617436-108617458 AGAGGAACAAATTGGGAGCTTGG + Intronic
913563718 1:120049149-120049171 ATATGTACCTATTGTGTGCTGGG - Intronic
913634406 1:120744414-120744436 ATATGTACCTATTGTGTGCTGGG + Intergenic
914284311 1:146208523-146208545 ATATGTACCTATTGTGTGCTGGG - Intronic
914545343 1:148659264-148659286 ATATGTACCTATTGTGTGCTGGG - Intronic
914621225 1:149411410-149411432 ATATGTACCTATTGTGTGCTGGG + Intergenic
915524751 1:156468700-156468722 GGAGGGACCTCTTGGGAGCTGGG - Intronic
916824952 1:168434377-168434399 AGAGCCACCCATGATGAGCTGGG + Intergenic
918375803 1:183908088-183908110 TCAGGCACATATTGAGAGCTAGG - Intronic
921719249 1:218452251-218452273 TGGAGCACCTATTGTGTGCTAGG - Intergenic
922061036 1:222091857-222091879 AGAGACAACTATTATGAACTGGG + Intergenic
924370259 1:243340403-243340425 AGGGTCACCTATTTTGTGCTGGG + Intronic
1066473751 10:35724653-35724675 AGAGGCACATATTCTGGGCTGGG + Intergenic
1068963952 10:62893176-62893198 TGAGGCCCCTATTCTGAGTTAGG - Intronic
1070370615 10:75778560-75778582 GGAGGCACCTGTGGTCAGCTTGG + Intronic
1070616229 10:77971413-77971435 AGAGGCGTCTATTTTTAGCTAGG + Intronic
1074776903 10:116773626-116773648 TGAGGCCCCCACTGTGAGCTGGG - Intergenic
1075598212 10:123747679-123747701 CCAGGCACCTAATGTGACCTGGG + Intronic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1079552576 11:21718442-21718464 AGAGGAACTTCTTGTAAGCTTGG + Intergenic
1080417953 11:32087155-32087177 AGGGGCACCTACTATGAGCCAGG + Intronic
1082808228 11:57463282-57463304 AGAAGCACCTATTTTGTCCTAGG - Intronic
1082942625 11:58724317-58724339 TGATGCACCTATTTTGAGCCAGG - Intronic
1085397709 11:76215371-76215393 ACAAGCACCTACTGTGTGCTAGG + Intergenic
1086875339 11:92089035-92089057 ACAGGGACCTATTGTATGCTTGG + Intergenic
1089875562 11:121718311-121718333 AGAGGCAGCTATGTTGGGCTTGG + Intergenic
1090801878 11:130178233-130178255 AGAGTCTCCTGGTGTGAGCTGGG + Intronic
1090808338 11:130216839-130216861 AGAGGCACCTTTCCTGTGCTCGG - Intergenic
1094050282 12:26212816-26212838 AGAAGCTTCTATTTTGAGCTTGG + Intronic
1095962783 12:47845825-47845847 AGAGGAAGTTATTGTGACCTTGG - Intronic
1096177431 12:49532075-49532097 TGAGGTACCTACTGTGTGCTAGG + Intergenic
1101259435 12:103013504-103013526 AGAGGCACCTAGTTTGGGGTGGG + Intergenic
1101860499 12:108478632-108478654 CTAGGCACCTACTGTGTGCTGGG - Intergenic
1102310915 12:111843617-111843639 ACAGGCATCTATTGGCAGCTTGG + Intronic
1103711649 12:122917321-122917343 AAAAGCACCTACTGTGAGCAGGG + Intergenic
1104075937 12:125389839-125389861 AGAGGCACCTATTATATGCAAGG - Intronic
1104241994 12:126999190-126999212 AAAGGCATCCATTGTAAGCTCGG - Intergenic
1110185162 13:72665303-72665325 AGACACACTTATTGAGAGCTTGG - Intergenic
1112160975 13:96867720-96867742 AGGGGCACCTAGGCTGAGCTAGG - Intergenic
1113820382 13:113209072-113209094 GGAGGCACCTTATGAGAGCTCGG - Intronic
1117003400 14:51394486-51394508 AGAGCCATTTATTGTTAGCTTGG + Intergenic
1120324489 14:83007648-83007670 AGTGGCACCTGTTCTGTGCTAGG - Intergenic
1125127612 15:36242476-36242498 ATAGGTACCTATTTTGAGTTTGG + Intergenic
1126373554 15:47971851-47971873 AAAGACACCTCTTGTGATCTGGG + Intergenic
1127178095 15:56382884-56382906 GGAGACACCAATTGTGACCTAGG - Intronic
1128561690 15:68672866-68672888 AGAGCCACATAATGTGAGCTCGG + Intronic
1129343333 15:74900511-74900533 AGAGGGACCCAGTGTGTGCTGGG - Exonic
1129552445 15:76467633-76467655 ACAAGCACCTATTATGTGCTAGG + Intronic
1130619113 15:85442869-85442891 ATGAGCATCTATTGTGAGCTAGG + Intronic
1132833046 16:1938836-1938858 GGAGGCACCTAGAGTGAGCAGGG + Exonic
1134302797 16:13006594-13006616 GTAAGCACCTATTGTGAGCCAGG - Intronic
1136744845 16:32577132-32577154 ACAGGGGCCTATTGTGAGGTGGG - Intergenic
1140031733 16:71344659-71344681 AGAGGCAGCAGGTGTGAGCTGGG + Intergenic
1140892644 16:79298344-79298366 AGAGGCACCTCTTGTTTGCAAGG + Intergenic
1141651055 16:85393473-85393495 TTAGGCACCTACTGTGTGCTGGG - Intergenic
1203024752 16_KI270728v1_random:498090-498112 ACAGGGGCCTATTGTGAGGTGGG + Intergenic
1203046969 16_KI270728v1_random:836341-836363 ACAGGGGCCTATTGTGAGGTGGG - Intergenic
1143084424 17:4405285-4405307 AGAGGCAGCTAATCTGGGCTTGG + Intergenic
1143589442 17:7872981-7873003 AGGAGCACCTATTATAAGCTTGG + Intronic
1143853630 17:9832093-9832115 TCAGGCACCTATTGTGGGCCAGG - Intronic
1144408599 17:14976721-14976743 AGTGCCACCTATAGTGAGCAGGG + Intergenic
1145973672 17:28971972-28971994 ACTGGCACCAAATGTGAGCTGGG - Intronic
1146680484 17:34803897-34803919 AGAGGCTGCTATTGTCAGCCAGG + Intergenic
1147778464 17:42921128-42921150 AGAGCCACCTATTGTTAGTTTGG + Intergenic
1150232997 17:63568784-63568806 AGAGACATGTATTGTGAGGTGGG - Intronic
1150942809 17:69711634-69711656 AGATGCACCTTTGCTGAGCTTGG + Intergenic
1152767620 17:82149641-82149663 AGAAGCCCCTCTTGTGAGCGGGG - Intronic
1157858449 18:51121426-51121448 GGAGGCACCAAGTGTGAGCGAGG + Intergenic
1162188387 19:8925043-8925065 TCAGGCACCTATTCTGGGCTGGG - Intronic
1163253564 19:16141296-16141318 AGAGGCACCCAGGGTGAGCCTGG + Intronic
925440547 2:3881554-3881576 AGTGGGACCTAGTGTGAGGTGGG + Intergenic
926292485 2:11541840-11541862 CGAGACACCTATTGTGTGCCTGG - Intronic
926834291 2:17000479-17000501 AGAGGAACCTAGTGTAAGGTAGG - Intergenic
928886481 2:36154559-36154581 AGAGGCACCTTTTATTAGCATGG - Intergenic
929575554 2:43049676-43049698 AGAGGCACCTGGTGAGACCTGGG - Intergenic
930020363 2:46998162-46998184 GGAGGCACCTCTTGTGGGGTTGG + Intronic
931547903 2:63409011-63409033 AGAGGGACCTGTGGTGAGCAGGG - Intronic
933797256 2:85929396-85929418 AGAGGCACCGAGAGTGAGCGAGG + Intergenic
934663808 2:96156879-96156901 AGAGGCAACTATAGGGAGCTGGG - Intergenic
936479426 2:112871339-112871361 AGAGGCAGCTATTCTGTTCTTGG + Intergenic
936736098 2:115445507-115445529 TGAGGAACCTATTGAGAACTGGG + Intronic
947040955 2:225918950-225918972 AGAGGCACCTATTATGGATTTGG - Intergenic
947177779 2:227384724-227384746 AGAGGCAGCTGTAGTCAGCTGGG - Intergenic
1168761892 20:354925-354947 AGGAGCACCTACTGTGTGCTGGG + Intronic
1169023030 20:2343950-2343972 AAAGGCAGCTATTGTCAGATTGG + Intergenic
1170511349 20:17080478-17080500 AGAGACAACTATTGGGAACTGGG + Intergenic
1172935802 20:38619277-38619299 AAAGGCCAGTATTGTGAGCTTGG + Intronic
1175741041 20:61419948-61419970 ACAGACACCTACTGTGTGCTGGG - Intronic
1178934893 21:36852753-36852775 GGAGGTACCTATTGTGCACTAGG - Intronic
1179402090 21:41093827-41093849 AGAGTCAAATATTATGAGCTGGG - Intergenic
1180966447 22:19790455-19790477 ATAGGCACCTACAGTGAGGTGGG - Intronic
1182294571 22:29305518-29305540 CGTGGCACCTACTGTGTGCTGGG - Intergenic
1184524361 22:45013061-45013083 AGAGGCACCTCTCTTGAGATTGG + Intergenic
949719701 3:6974558-6974580 AGAGGAGCCTCTTGTGAGGTAGG + Intronic
950494014 3:13323073-13323095 ACAGGCACCTTCTGGGAGCTGGG + Intronic
952114129 3:30159031-30159053 AGAGGGAGCAATTATGAGCTAGG - Intergenic
956823154 3:72972348-72972370 AGAAGCATATATTCTGAGCTGGG + Intronic
964494480 3:157273404-157273426 AGAGGCACTTATTCTAAACTGGG + Intronic
965732297 3:171785000-171785022 AGGTGCACCTATTTTAAGCTCGG + Intronic
969464447 4:7347408-7347430 AAAAGCACCTATTGTGTGCCAGG + Intronic
971218053 4:24680359-24680381 TGAAGCACCTATTGTGTGCCAGG - Intergenic
972103837 4:35457496-35457518 AGAGGGACCTTGTGTGAGCAAGG + Intergenic
973974378 4:56247548-56247570 AGAGAATCCTGTTGTGAGCTGGG + Intronic
974270937 4:59651006-59651028 AGAGGAACTTATTGGGAACTGGG + Intergenic
978360600 4:107927456-107927478 AGATGAATCTATTGTGAGGTGGG - Intergenic
978729062 4:112003658-112003680 AGAAACACCTATTGTGAACTGGG + Intergenic
981901188 4:149865720-149865742 AGTGGCACCTTTTGGGAGCAGGG + Intergenic
986287915 5:6373649-6373671 AGAGGCACCTATTGTGAGCTGGG + Intronic
989003128 5:36782434-36782456 AGAGGCACCAAGAGTGAGCGAGG - Intergenic
989182782 5:38595284-38595306 AGAGGCTCCCTTTCTGAGCTGGG + Exonic
991197446 5:63952914-63952936 AGAGGCAACTGTTTGGAGCTTGG - Intergenic
997220490 5:132158153-132158175 AGATACACCTATTGGGAGGTTGG + Intergenic
997385605 5:133469720-133469742 AGAGGCACCCTTGGTGAGCAAGG + Intronic
997472147 5:134123102-134123124 GGAGGCACCTACTGTGTGCTGGG - Intronic
999175255 5:149627499-149627521 TGAAGCACCTATGGTGTGCTGGG + Intronic
1003380374 6:5619523-5619545 AGAGGCCCCTTTAGTGACCTGGG - Intronic
1004340128 6:14801020-14801042 AGAGGCACCAATGGCGAGCATGG + Intergenic
1006901728 6:37507197-37507219 AAGGGGGCCTATTGTGAGCTAGG - Intergenic
1013091723 6:106906307-106906329 AGGAGCAGCCATTGTGAGCTGGG + Intergenic
1016246997 6:141994636-141994658 AGTGGCAGCTACTGTGAGCAGGG - Intergenic
1018386148 6:163305085-163305107 ACAGGCACCGAGTGTGGGCTCGG - Intronic
1022106473 7:27200571-27200593 AGAAACACCCATTCTGAGCTAGG - Intergenic
1027776417 7:82471073-82471095 AGTGGCACATATTGTTTGCTTGG - Intergenic
1031897469 7:127367919-127367941 AGATGCACCTATGGTATGCTAGG + Intronic
1038323204 8:26548271-26548293 TGAGGCACCTATGGGGAGATCGG + Intronic
1041126286 8:54643582-54643604 AGAGTCACCTCTTGTTTGCTGGG + Intergenic
1042505397 8:69554340-69554362 AAAGGCACATATTATGATCTAGG - Intronic
1043558519 8:81462810-81462832 TGAGGCACTTATTTTGAGCTTGG - Intergenic
1045565600 8:103311314-103311336 ATAGGCACCTAATCTAAGCTTGG - Intronic
1047689930 8:127341456-127341478 ACAGGCACCAACTGTGTGCTGGG - Intergenic
1050696529 9:8285677-8285699 AGAGGGACTTATTGTGAACCAGG - Intergenic
1051184067 9:14440146-14440168 TGAGGCACCTGGTGTGAGCTGGG + Intergenic
1051828891 9:21253522-21253544 GGAGGAAGCTATTGTGAGATGGG + Intergenic
1061953662 9:133950366-133950388 AGAGGCACCTACTGCATGCTAGG + Intronic
1062006460 9:134240723-134240745 TTAGGCACCTACTGTGTGCTAGG + Intergenic
1196122491 X:112065951-112065973 AGAGGTACCTTTGGAGAGCTAGG - Intronic